Saturday, August 31, 2019

Woody Allen’s Sleeper Woody Allen’s Sleeper

â€Å"Sleeper† is a film, which at first glance, appears to be about nothing but making people laugh, but when examined more closely might appear to be a commentary on politics, consumerism and even love. This film is supposed to be Woody Allen’s take on a modern silent film, and there are definitely similarities to the silent film classics of Buster Keaton and Charlie Chaplin, most notably the physical humor that defined the slapstick sub-genre of comedy.Scenes like those with the giant produce or the awakening of Woody Allen’s character, Miles Monroe are absolute gems and caused me to laugh hysterically the first time I saw them. They also appear to only exist for the sole purpose of making the viewer laugh. If the main character in a film only believes in â€Å"sex and death† does that imply that the main point of the film is also sex and death? At first glance, the slapstick nature of the film appears to support part of this claim as the futuristic soc iety in which Miles has woken up appears to be obsessed with ways of increasing pleasure- both emotionally and sexually.We see a glimpse of this culture during the dinner party hosted by Luna in which the Orgasmatron and the Orb are introduced for the first time. The scene in which Miles is acting like a robot and trying to pass around the orb, but only drugging himself is hilarious and the introduction of the Orgasmatron is absolutely ridiculous since Luna says, â€Å"I think we should have had sex, but there weren’t enough people. † Suddenly, sex is something that appears overly complicated and has been replaced by machines.One of the two things that Miles believes in has been replaced by machines and technology. In fact, I argue that the other thing he believes in – death- has also been replaced by machines and technology. Miles has been cryogenically frozen for 200 years- obviously he should have been dead by now. Instead, technology has taken away the other thing he believes in. So what then, does Miles and consequently the film believe in? Obviously the future, in which Miles has found himself in, is run by a Totalitarian government led by a dictator whom he spends a large majority of he film trying to overthrow. Is the film a political commentary then? Certainly, Woody Allen spends a lot of time highlighting the police force and the rebel faction which has formed against the government. He even manages to throw in a few quips regarding the politics of 1973 America. We see the absolute uselessness of said police force and we hear Miles comment on how the rebels will simply replace the existing government in a cyclic fashion. But there still isn’t enough. Even the romance between Miles and Luna seems to be empty and almost like an afterthought.I just don’t think that there is enough substance to qualify this as a political film, a commentary on consumerism or even a romance story. In the end, I argue that maybe this movi e isn’t really about anything at all. Maybe it is simply a funny film that highlights screwball comedy and has some of the elements of a science fiction movie. Whether or not it is a movie with a deeper message, â€Å"Sleeper† is still a movie that I thoroughly enjoyed and a great introduction to Woody Allen.

Friday, August 30, 2019

Prevention Of A Disease Health And Social Care Essay

The current definition of wellness is â€Å" being sound in organic structure, head or spirit † ( Gordon, 1988 ) . It differs from the traditional definition which defined wellness as â€Å" being free of disease † . Hence both of these definitions include the construct of an person ‘s well being by taking all those steps which can maintain him free of the disease. The thought of function of diet and other preventative steps in disease is non a new one as Hippocrates ( 460 BC – 377 BC ) said â€Å" our nutrient should be our medical specialty. † The same impression was supported by Thomas Edison ( 1847-1931 ) the celebrated discoverer, when he said the â€Å" physician of the hereafter will give no medical specialty, but will involvement her or his patients in the attention of the human frame, in a proper diet, and in the cause and bar of disease † . The bar of a disease includes a figure of factors both at the degree of an single and at the degree of community. It has evolved as an independent subdivision of medical specialty including many subjects such as anthropology, epidemiology, the designation and survey of diseases hypertext transfer protocols: //www.wisegeek.com/what-is-disease-prevention.htm. Harmonizing to figures â€Å" preventable diseases/illness † history for 80 % of the entire load of unwellness and 90 % of the entire wellness attention costs ( hypertext transfer protocol: //preventdisease.com/prevention/prevention.html ) . Furthermore, they account for eight of the nine taking classs of death.A Assorted factors lending towards disease bar are restricting smoke and consumption of intoxicant, a healthy diet, effectual exercising, physical activity and weight control, decrease of emphasis and regular showing and trials ( hypertext transfer protocol: //www.phac-aspc.gc.ca/cd-mc/healthy_living-vie_saine-eng.php ) . In instance of bar of sexual diseases, the steps will include safe sex etc. ( Well, 2010 ) . As justly mentioned by Thomas Edison, an person ‘s nutrient and diet have been recognized to hold a function in wellness and disease ( Branca et al, 2001 ) . Assorted dietetic factors play influential function in most common and of import wellness issues. Harmonizing to WHO, the coronary bosom disease, shot, malignant neoplastic diseases and diabetes mellitus are among the top 10 causes of decease in high-income states ( WHO, 2008 ) . The etiology of these diseases is multifactorial nevertheless, there is some possible for dietetic use ( Branca et al, 2001 ) . This is most applicable in instance of coronary bosom diseases and shot where the dietetic factors play their portion by transition of blood lipoids and their leaning for oxidization. The inclusion of fish oils in diet lessening the opportunities of thrombosis ( Kromhout et al, 2001 ) . In instance of malignant neoplastic diseases, fats, fiber and anti-oxidant vitamins and minerals have been related to development of mali gnant neoplastic disease. Dietary factors account for 30 % of all malignant neoplastic diseases in Western states while 20 % of all malignant neoplastic diseases in developing states ( WHO, 2010a ) . Another important factor that plays a outstanding function in disease bar is the life-style form. Physical activity and exercising are the most of import determiners of life manner form while other factors include smoke and intoxicant etc. ( WHO, 2010a ) . These effects of diet and life manner forms have been widely recognized and this can be shown by the fact that the recommendations on diet and life manner are advised to diminish the hazard of bosom disease by CDC ( 2009 ) and WHO ( 2010b ) . Furthermore, early sensing of some diseases such as cervical showing for cervical malignant neoplastic disease, mammograms for early sensing of chest malignant neoplastic disease, regular monitoring of cholesterin and blood force per unit area for bosom disease besides contribute to disease bar. A survey ( Wannamethee et al, 1998 ) to place the consequence of assorted hazard factors associated with bosom diseases was carried out. It examined the combined consequence of assorted life manner patterns non merely on the survival rates but besides 15 twelvemonth endurance rates with a cardiovascular disease and diabetes free life. It was revealed that a 50 twelvemonth old adult male has an 89 % opportunity of lasting to 65 without developing coronary bosom disease, stroke or diabetes if he has ne'er smoked, is physically active and non fleshy. On the other manus, if he smokes, is inactive and really overweight he merely has a 42 % opportunity. It can be therefore inferred that the control of many of the preventable factors can hold a positive influence on dearly-won and crippling conditions such as cardiovascular diseases, malignant neoplastic disease, diabetes and chronic respiratory diseases ( WHO, 2002 ) . With the addition in the people populating with the chronic conditions for old ages and old ages, these diseases are thought to hold a potency of going the most expensive jobs faced by our wellness attention systems. Hence an effectual and successful bar and direction of these diseases has been identified as indispensable or otherwise chronic conditions pose a menace to all states from a wellness and economic point of view ( WHO, 2002 ) . However, it was recognized that the health care systems do non do the best usage of their available resources to pull off the procedure of disease bar ( WHO, 2002 ) . This has besides been highlighted by others and it was advocated that â€Å" wellness † industry would be better named as â€Å" illness † industry due to its tendency on handling the symptoms of disease once it has been contacted instead than bar of the disease runing from common cold to cancerous conditions ( Pilzer, 2005 cited in hypertext transfer protocol: //elib.kkf.hu/okt_publ/szf_26_09.pdf ) . As a consequence of this, new industry has been developed which is the â€Å" health † industry which focuses on doing people stronger and healthier. All over the universe it is already a $ 200 billion concern with most of the gross coming from dietetic addendums while harmonizing to Pilzer ( 2005 cited in hypertext transfer protocol: //elib.kkf.hu/okt_publ/szf_26_09.pdf ) another extra $ 1 trillion of the economic system will be devoted to wellness merchandises and services. Owing to the load of preventable disease and old deficiency of focal point on disease bar, in 2002 WHO recommended that every wellness attention should include bar support programmes ( WHO, 2002 ) . This recommendation to the full supports Edison ‘s statement and it can be said that his anticipation was right about the hereafter of medical specialty. If patients are consistently provided with all the information about the hazard factors such as baccy, intoxicant, safe sex, healthy nutrients and physical activity. Such information can cut down the long-run load and wellness attention demands dramatically. WHO advocated that in order to advance bar in wellness attention, there is a demand for raising consciousness and advance a alteration in thought of patients, households and wellness attention squads, communities and policy shapers. At primary wellness attention degree, a collaborative direction attack with patients, their households and wellness attention professionals is indi spensable to efficaciously diminish the preventable diseases which contribute much to the load of disease ( WHO, 2002 ) . These programmes promote the entree to preventive wellness attention by the agencies of primary attention doctors. In US, this was achieved by integrating bar into primary wellness attention by managed attention organisations ( MCOs ) ( WHO, 2002 ) . These MCOs can work efficaciously as they have big, chiseled populations and have informations about wellness and wellness attention which let them to turn to the bar steps. Such a programme would hold been about impossible in a disconnected wellness attention bringing system ( Hall, 2005 ) . NHS has besides developed assorted wellness attention preventative programmes for different diseases such as coronary bosom disease, high blood pressure, diabetes and assorted malignant neoplastic diseases. For illustration NHS program includes join forcesing with other bureaus and develop, implement and proctor policies to cut down the hazard factors in the population. This is done by affecting the general practicians and primary attention squads in placing patients with established cardiovascular disease ( CVD ) and advice them to cut down hazard factors. They besides identify the people at hazard of CVD and offer them comprehensive advice ( hypertext transfer protocol: //www.dh.gov.uk/en/Publicationsandstatistics/Publications/PublicationsPolicyAndGuidance/Browsable/DH_4902634 ) . Furthermore, testing programmes for chest malignant neoplastic disease and cervical showing are besides runing. Inoculations available for assorted diseases to susceptible persons besides contribute to these preventative programmes. In conformity with Thomas ‘s statement, it is the physician or doctor which plays a cardinal function in emphasizing the preventative steps. However, due to continued disease theoretical account patterns, doctors might be really sabotaging the preventative services ( Hall, 2005 ) . Assorted surveies suggest that there is a deficiency of physician engagement in preventative services and doctors perform 20 % to 60 % of the preventative activities that have been recommended. However, most of the doctors believe that patient instruction about preventative steps and hazard factors is the duty of doctors ( Hall, 2005 ) . In add-on to doctors ‘ function, there is a demand for stairss to be taken at community degree for disease bar. At the degree of community, different disease bar schemes have been developed. These include stairss such as sanitising imbibing H2O, clean life conditions, widespread inoculation programmes. These programmes have proved effectual in communities on a wider graduated table while the physicians or doctors can still concentrate on single patient instruction ( http: //www.wisegeek.com/what-is-disease-prevention.htm ) . In drumhead although preventable diseases contribute significantly to disease load nevertheless they can be prevented. Assorted schemes that can cut down these diseases include healthy diet, cut downing smoke and intoxicant, early sensing and increasing physical activity. Health attention systems can integrate effectual preventative programmes affecting patients, their households, doctors and other wellness attention suppliers.

Thursday, August 29, 2019

Best Buy CEO Chairman Relationship Research Paper

Best Buy CEO Chairman Relationship - Research Paper Example 17). As expounded, the reported improper relationship, despite the allegations being denied by both Dunn and the employee, has caused a damaged morale within the organization, supposed distractions, and speculations on the true nature of the relationship. Issues Being Addressed The issues being addressed in this case are violations of transparency, violations of conformity to ethical and moral standards, and failures to disclose critical information to the Board of Directors, which could assist in addressing the issues in a more professional manner consistent with the standards posed under corporate social responsibility. The World Business Council for Sustainable Development (WBCSD) has defined corporate social responsibility (CSR) as â€Å"the continuing commitment by business to contribute to economic development while improving the quality of life of the workforce and their families as well as of the community and society at large" (WBCSD par. 4). Obviously, the violations and i ssues noted from the case at Best Buys undermined ‘improving the quality of life of the workforce’ due to causing apparent distractions and speculations. Likewise, the improper relationship of Dunn, a married man, with a 29-year old employee caused conflicts in the marital relationship with Dunn’s spouse and the relationship with his children. The relationship is deemed as violating the standards of ethics and moral codes. The situation was exacerbated by Schulze’s failure to disclose the investigations made by him to the Board based on previous reports, which was an apparent violation of the rules of transparency and the rules on partnering to stop misconduct (Best Buy, n.d.). Rules According to the report written by Clifford (2012) and published in The New York Times, the rules and company policies on adherence to ethical and moral codes of conduct have apparently been applied to all employees except the CEO. As cited, â€Å"the C.E.O.’s relation ship with this employee led some employees to question senior management’s commitment to company policy and the ethical principles the company champions† (Clifford par. 17). Best Buy has a Code of Business Ethics that explicitly states rules on responsibility to each other, responsibility to shareholders, and responsibility to the company’s business associates – the areas where some violations have been noted. Analysis Upon closer examination of Best Buy Code of Business Ethics, the violations noted were on the rules pertaining to the following: (1) responsibility to each other, particularly honoring our differences; (2) responsibility to our business associates, particularly conflict of interest; (3) gift giving; (4) partnering to stop conduct. The Code of Business Ethics stipulated that â€Å"one of our values is to show respect, humility and integrity. Creating a positive work environment supports this value† (Best Buy 14). The actions of Dunn an d the female employee have been reported to cause conflicts in the work environment that apparently led to low morale. Likewise, the inability of Schulze to disclose the information immediately was a weakness on his character, pursuant

Wednesday, August 28, 2019

Allowing Teenage Driving before the Age of Eighteen Essay

Allowing Teenage Driving before the Age of Eighteen - Essay Example Accidents due to teenage driving in this group are more in comparison to accidents from other age groups. III. Teenage drivers below the age of eighteen years have very poor driving skills, which disregard all the rules. A. Drunk driving is a major issue associated with teenagers below the age of eighteen years. It is crucial to note that alcohol impairs once mind affecting their coordination and thinking. B. Parents’ failure to be strict on the rules made teenagers below the age of eighteen years fail to observe even the most of basic rules like using the seatbelts. IV. Most teenagers in this age group do not understand the complexity involved in driving. A. Teenagers’ social and emotional development of their minds is immature in comparison with that of an adult. B. They are vulnerable to distraction and peer influence. V. Teenagers below the age of eighteen years should drive. A. Some members of this group are mature, responsible, and dependable. In effect, locking p rohibiting them from driving is discriminatory. VI. No teenager should drive. B. The dependable and responsible teenagers in this group are a minority. In effect, none should drive. VII. In conclusion, accidents resulting from teenage driving result to half of the causes of the deaths in this group. In effect, none should drive since allowing them to drive puts them at a risk of vulnerabilities. Allowing Teenage Driving before the Age of Eighteen Years In the current world, characterized by the information and the knowledge economy, the debate about the right age to drive has remained in the public domain for a period. In fact, different countries have enacted different legislation regarding the right, or rather the legal, age for driving. Indeed, most people agree that the art of driving does not require the skills learned in a driving school only. Rather, one of the most important requirements of a skilled driver is good decision-making at all times, and in other cases within a sp lit of a second. However, good decision-making skills are not skills that an individual learns in a driving school. In fact, good decision-making skills are inherent in an individual with the maturity level being a significant determinant. While some people argue that teenagers below the age of eighteen years should drive since some are mature, this essay posits that teenagers below eighteen years should not drive since they are vulnerable to risks associated with driving. A 1983 study by Karpf and Williams observed, â€Å"Nearly half the deaths of male and female 16–18 year olds in the United States resulted from motor vehicle use† (as cited in William & Lund, 1986). However, recent research by Chen, Baker, Braver, and Li (2000), noted that the deaths of this age group due to accidents stood at 36% towards the end of the last century. Nevertheless, this percentage is a manifestation of a grim scenario concerning licensing of teenage driving below the age of eighteen y ears. Therefore, prohibiting driving amongst this group would help reduce the number of deaths by a big percentage in this vital group. While observing that the statistics were from a developed country and their application to other countries may differ, it is essential to note that these dynamics may apply to any nation regardless of its development. In this regard, teenagers' dynamics are common or

Tuesday, August 27, 2019

Summary and thesis development Essay Example | Topics and Well Written Essays - 750 words

Summary and thesis development - Essay Example As a result, people who frequently watch television shows tend to develop unbalance and unrealistic view of things in the real world. Presenting the ideas of Gerbner, Waters specifically criticises the depiction of characters as well as various ideas in terms of gender, race, sex, health, age, crime and work among other groupings. For example, Waters believes that crime is presented on television in a manner that it appears on the screen over ten times as it is in reality. He argues that presentation of crime on television has high propensity to promote aggression among the viewers. Crime featured in television shows inculcate certain lessons in social sphere by depicting what one person can do to another and go unpunished. While all the representation of characters on television shows are crucial for various reasons, Water’s critique, especially, of the way crime and race are depicted on prime television is very significant and relevant. The big questions are: does Waters’ criticism of crime and race presentation relevant to the modern society? Does it have a bearing on deviant behaviours witnessed in everyday life? Owing to the fact that the modern society is characterised by high crime rates and racially motivated actions, one can agree less that television shows can have a profound influence on the decisions that people make when confronted with certain issues in real life. The show Friday Night Lights is an epitome of a television show that can greatly influence the choices of its lovers. In particular, the episode of season two of the popular television drama features a gruesome murder of a man by a character who is a member of the show’s high school crew. The murderer pulls the trigger in response to an attempted rape on the girl he likes. Afterwards, he conspires with the girl to conceal the body of the victim so as to keep the crime under cover. Landry

Monday, August 26, 2019

The Context of Legislative Decision Making Essay - 1

The Context of Legislative Decision Making - Essay Example In a democratic set up, unless the majority members do not accept the passing, it would not be able to be carried and therefore, the motion would be negated. Therefore, it is the elected representative of the people, who, as members of the Parliament, are having the discretionary powers to accept or deny the motion. They are effective because only the legislation which have the unanimity of approval would be passed. However, although the approvals are required, it is often possible for interest groups to lobby for vested interests, and they may use their power of influence to gain benefits. The main difficulties that may be faced in studying party politics in the state legislatures is due to frequent switching done by the legislators, which makes it difficult to gauge the political situations. When legislators switch parties due to misunderstandings or misconduct, it may have impact on the proceedings of the legislature and this is one of the main difficulties in studying the state legislations. The interest groups or professional lobbyists act to influence the legislative process when they need to secure passing of Bill by influencing public officials through information dissemination and also to influence or mould the minds of the public officials for reaching decisions though debating. The strategic effect of the effectiveness of lobbying is when the professional lobbyist is able to secure the passing of the legislative bill through successful lobbying. Lobbying in Brussels was developed in the late 1970’s the event that ignited the lobby aspects was the direct election in the European Parliament in 1979. The business circles felt that they needed persons who could supply them with information about political activities. The passing of the Single European Act 1986 created avenues by which decision in councils could be enhanced through the use of lobbying through the councils, the commissions and

Sunday, August 25, 2019

Psalms Essay Example | Topics and Well Written Essays - 1500 words

Psalms - Essay Example This psalm describes the wedding banquet with Christ and His church, and Christ’s eternal kingdom. The psalm describes the setting around the time of the Feast of Tabernacles. During the feast the reading of the Law was given to the people. The psalm describes how we should be God fearing people and respect God’s Word. The psalm in verse 22 speaks of how God will tear you to pieces. Then, the psalms say he prepares the way. This psalm shows us the need for a savior that is Jesus Christ. God has shown His compassion by sending His son once and for all as a sacrifice for sin. The psalm describes the scene as a heavenly courtroom, with the Mighty One -- God -- as the judge. The Lord hands down an indictment against hypocrisy. The psalm indicts people who practice formalism in worship. However, Christ advises us to â€Å"worship in spirit and truth† (John 4:24). This psalm is Messianic in nature; the commentary describes the psalm as an imprecatory psalm. This psalm has become a popular psalm over the years. Verses 1 thru 18 of the psalm speak of the need for a Savior. This savior is The Messiah, Jesus Christ. David continues to discuss the Lord’s compassion and loving-kindness. Then, verses 19 thru 29 describe David’s vindication from his enemies. The psalm ends with praise and looks forward to the Messiah and the coming of his eternal kingdom. The prevailing Messianic tone was prayer for deliverance from suffering for the Lord’s sake. Therefore, Christ was seen as the one who was persecuted for doing God’s will. Psalm 72 refers to certain elements that will make up the millennial kingdom, where Christ will reign. The psalm goes on to explain how Christ will reign with righteousness throughout the whole world. This particular Messianic prophecy is seen in verse 1-3. Christ reigning with compassion is seen in verses 12-14. Furthermore, we see that the nation will prosper; this prophecy will be

Saturday, August 24, 2019

Field Report Essay Example | Topics and Well Written Essays - 1500 words

Field Report - Essay Example re resources in the natural history of Victoria and even beyond its boundaries (Melbourne Museum, 2015, retrieved from http://museumvictoria.com.au/melbournemuseum/about-us/). The museum is divided into three venues: immigration museum, science works and the Melbourne Museum. The Melbourne Story exhibition is found in the Melbourne Museum. It shows the history of the Melbourne starting from when the white settlers and  the local indigenous people got into contact. The history is connected in the form of stories, soundscapes, images, artifacts and interactive components. This ensures that the visitors have an insight into the Melbourne story. This story shows the Australian history which covers the rich, poor, settlers, indigenous people, immigrants, and how they survived as Australia developed. The Melbourne Story is a comprehensive exhibition that has abundant information about the city of Melbourne. The collections are presented in such a way that they reveal the extraordinary riches of the city. There is an amazing hand colored lithograph that shows the olden city of Melbourne in 1858 (Museum Victoria, 2001, p. 21). The picture, which was developed by George Rowe, shows the ancient city. The buildings and the mode of dressing simplify a time when Australia was under-developed. Each object in the museum displays a certain historical time, and they are all organized in a chronological manner. All the pictures are taken and printed using the available technology of that particular time. Through this presentation, the museum manages to show the lifestyle and technology of the Australian people at different historical times. There are various jar bells and stuffed animals that create and antique display of the people living in Melbourne during the Victorian period. There is a video footage that covers a football match which is believed to have been taken between 1900 and 1920 (Museum Victoria, 2001, p. 43). The video is of low quality but in relation to the

Computer Networks Essay Example | Topics and Well Written Essays - 2250 words

Computer Networks - Essay Example The larger firms have their own computers connected in the topology suiting best to their requirements. They choose for themselves from the different options available like bus, ring, star, mesh and the like. The protocols used for the data transfer stays to be the same. We take the example of the call center, as they require a large number of computers for providing online support to a large number of people utilizing the services provided by the firm. The protocols used for the data transfer are standard and are generated utilizing the international standards for communication languages. The call center backbone should be strong enough so as to meet the pressing requirements of online support to millions of users staying far and wide and utilizing the services of the organizations. The critical issue in the call center stays to be that the information and the calls need to be routed to the lines which are free at that very moment and these lines should be relieved back to the pool when they are no more used. Next, the information needs to be collected in the central database so as to store the information and personal details about the scheme offered to the clients and their personal information too. The financial system at the back needs to be connected to the front end Customer relationship and maintenance software package, so that the information updated by the CRM department directly gets recorded in the back end ERP system. This saves a considerable amount of time and effort by eradicating the factor for double data entry in both the front end and the back end. For this the cutting edge technology is utilized to develop new softwares and other data integration and migration utilities which connect both the financial system as well as the front end CRM. Next important factor is to maintain the connectivity of the database with the financial system, so as to maintain the records in the system and all the information in a systematic format following the specific schema. The topology preferred for the call center is the bus topology wherein several computers need to be bifurcated in the form of branches from the central bus which is stronger enough to provide the connectivity to a wide number of computers. The chief advantage of the bus topology stays to be that the network is never disconnected even if a single computer is not upright in the channel i.e. it doesn't affect the connectivity of the other computers connected together in the firm. [Computer Networks] The connection stays to be the same for the complete network of the organization as well as the subnet of it. All the smaller subnets are connected with each other via an instrument called a router which routes the call to the desired departments within the organization. These routers and the gateways are the interconnecting devices which can be either active or passive depending on the amount of the power they consume. This connecting device helps in connecting and forming a bigger network. The whole network is protected with the firewalls so as to maintain the security and integrity of the system. The protocols for the network stay to be the same whether it is a small firm or a large wide area network. The protocol used for the call ce

Friday, August 23, 2019

Deloitte Company Internal Communication Assignment

Deloitte Company Internal Communication - Assignment Example Deloitte operates on the logic of being the first choice of the world’s best talents as reflected in eminence, diversity, and culture (Deloitte 2012 Global Report, 2012). The company’s vision also connects with the need to attract the world’s best clients through the provision of excellent service in the different business segments that define its business operations. The company’s mission is to offer measurable value to its global clients through its vast network of professional diversity and remarkable expertise. Deloitte defines its culture around shared values, which connect its people across the globe with the objective of cultivating trust between partners and professionals in a way that promotes the levels of confidence in the capital markets (Deloitte 2012 Global Report, 2012). The values espoused in the company’s culture enjoin all the employees of varied origins, languages, cultures, and customs to work with the single purpose of achieving collective successes. Such a broad and comprehensive cultural framework was designed in conformity with the global reach of the company’s firms. Deloitte seeks to align its culture with universal standards in order to meet the diverse needs of its global clientele (Deloitte 2012 Global Report, 2012). ... Deloitte is guided by the ethics of collaborative and people-focused culture, which enhances mutual respect, ongoing learning, and open communication. Past and recent audits on the firm’s performance indicate a trend of consistent growth in performance, brand profile, clientele, and profits.  

Thursday, August 22, 2019

This Is Reggae Music Essay Example for Free

This Is Reggae Music Essay Jamaica has been known to be a tourist spot in the Caribbean Islands, because of the stress relieving feel in being one with natures elements.   Apart from Jamaicas notoriety as a tourist destination,   it also prides itself   with one of the most influential and popular musical styles of the contemporary era, Reggae.   Beginning from its humble origins during the 60s, Reggae has become a powerful forcein the field of music, which spawned various publications such as Lloyd Bradleys , This is Reggae Music: The Story of Jamaicas Music.   Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚   The book primarily follows the birth and development of Reggae during the 60s in a defining and clever manner.   During the time when other musical genres, especially those not of European or American origin, a Jamaican musical style rose to the occasion and proved that Reggae has transcended from the dim hopes of ever being recognized globally.   In a more significant perspective, Bradley explains that Reggae possesses a certain attitude that main stream music and artists fail to have, dedication (Bradley, 2001).   Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚   Reggae has always been and always will be music for the people (Bradley, 2001), unlike the conventional tendencies of popular musicians who appear to exert less effort in making good music as their careers progress. The attitude that Bradley speaks of pertains to compassion for the listeners and not the headstrong arrogant tendencies of several popular recording artists and musicians.   Furthermore, Bradley states how Reggae is all about the music and the fans rather than the life, the fame and the glory.   Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚   An ordinary listener would usually think of Bob Marley when the word Reggae is uttered, not that Bob Marley has given Reggae a bad name, but Reggae has more depth and substance further than what Marley offered. And if Marley would have been alive, he would not approve of his status as the epitome of Reggae.   In relation, Bradley has given life to Reggae as a musical style and as a culture.   He bequeaths the reader with a detailed account of Reggae from the root down to the audio systems used.   Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚   Bradley begins This is Reggae Music: The Story of   Jamaicas Music with a listeners or a fans point of view wherein he describes the experience of being in a crowd watching a Reggae performance (Bradley, 2001).   Most musicians describe music or making music as something extraordinary in a sense that one would feel vibe or bolts of electricity flowing through the bloodstream, Bradley however describes making Reggae music as something magical or extraordinary as far as experience is concerned (Bradley, 2001).   Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚   The book then explains how the simplicity of Reggae came to describe it as music to the people, as the technicalities of dancing similar to disco and early Rock and Roll hits are explained as not the point of concern, the point of being among your own people (Bradley, 2001).   Bradley then segues in to a testimony of the life of Reggae as a versatile one, he describe its religious inclinations, social and cultural perspectives, and the global competence of Reggae as an art.   He also described the life of a Reggae musician in contrast to the Rock and Roll lifestyle of Sex, Drugs, and Rock Roll, with that said, Bradley insinuates that Reggae is not a slave to fame.   Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚   Bradleys This is Reggae Music: The Story of   Jamaicas Music indicates the various styles, that Reggae has innovated and adopted, though not all of them are original .   The soul style which is a derivative of Jazz was adopted by Reggae, but the soul style of Reggae as Bradley describes concerns emotional harmonies of lyrics and instruments with a Reggae feel (Bradley, 2001).   Bradley also discussed the new dances that have emerged from the sub-genres of Reggae as well as how the evolution of technology went hand in hand with Reggae (Bradley, 2001).   Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚   In a different note, Bradley has also described how Reggae died after the 1970s, he   particularly expresses his strong feelings of dislike for Marleys distinct style.   He also disliked Marleys political motivation of songwriting and how it tends to be corruptive.   He also forcibly placed   Reggaes globalization in a positive light, specifically, the British Reggae in the latter chapters of the book (Bradley, 2001).   The globalization topic, though finely detailed somehow ruins the presentation of the publications as Bradley tends to contradict his own opinion in discussing British Reggae.   Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚   Bradley has come up with fine detailed work in explaining an underdog music that made its mark in the world.   Though there are certain flaws and biased points of view, Bradley still managed to give a vast explanation of Reggae and how it developed from a simple musical style in to a global phenomenon.   Bradley has introduced readers, listeners, musicians and non-musicians alike to the real road to reggae with a little bumps along the way. References Bradley, L. (2001). This is Reggae Music: The Story of Jamaicas Music . New York: Penguin   Ã‚   Books.

Wednesday, August 21, 2019

UCA1 in Cisplatin Induced Ovarian Cancer Cell Resistance

UCA1 in Cisplatin Induced Ovarian Cancer Cell Resistance The Expression of Long Non-coding RNA UCA1 in Human Ovarian Cancer Cells and Its Role in Cisplatin Cytotoxicity in Vitro Running title: UCA1 in cisplatin induced ovarian cancer cell resistance Highlights Increasing expression of UCA1 RNA was found in ovarian cancer tissues. UCA1 can increase the cell migration, invasion and cisplatin resistance. The effect of UCA was extended through targeting SRPK1 and apoptosis related pathway. Abstract Objective: The therapeutic potential of cisplatin in ovarian cancer treatment is limited by the occurrence of cellular resistance. To explore the role of long non-coding RNA UCA1 in cisplatin induced ovarian cancer cell resistance. Methods: Twenty-four ovarian cancer tissues and sixteen normal tissues were used to assess the expression of UCA1 RNA. After expression UCA1 in SKOV3 cells, the cell migration, invasion and cisplatin resistance was assessed. Furthermore, the related mechanism was also explored. In addition, SRPK1 knockdown cell line was established and the effect of SRPK1 on cell migration, invasion and cisplatin resistance was also evaluated. Results: The increased expression of UCA1 RNA was identified in 24 ovarian cancer tissue compared with normal tissue. Expression of UCA1 RNA in SKOV3 cells increased the cell migration, invasion and cisplatin resistance. Alternated expression of SRPK1 and apoptosis related proteins were found in SKOV3/pcDNA-UCA1 cells. The effect of UCA1 expression on cell migration, invasion and cisplatin resistance was reversed by knocking-down SRPK1 in SKOV3 cells. Conclusions: Increasing expression of UCA1 RNA was found in ovarian cancer tissues. UCA1 can increase the cell migration, invasion and cisplatin resistance. The effect of UCA was extended through targeting SRPK1 and apoptosis related pathway. Key words: Long non-coding RNA, UCA1, SRPK1, cisplatin resistance, cell migration, invasion Introduction Ovarian cancer is the second most commonly diagnosed gynecological cancer in the world, and causes more deaths per year than any other the female reproductive system related cancer(1). More than 200,000 cases are newly diagnosed and 120,000 women die of ovarian cancer annually all over the world(2). Platinum based chemotherapy is active in ovarian cancer treatment. However, intrinsic or acquired cellular resistance to cisplatin is encountered regularly and severely limits the therapeutic potential of the drug(3). Multiple biological processes, such as dose accumulation, metabolism, apoptosis, DNA damage, are involved in the mechanisms of cellular resistance(4). Conquering cisplatin resistance remains therefore a critical goal for anticancer therapy and considerable efforts have been undertaken to solve this problem throughout the past three decades. Previous studies have shown that serine/arginine-rich protein-specific kinase 1(SRPK1) and apoptosis related protein are closely related with cisplatin resistance. SRPK1 is a kinase which belongs to SR kinase family (5). Through regulating the phosphorylation of SR splicing factors, SRPK1 can afftect the pre-mRNA splicing and consequently gene expression (6). Increasing attentions have been paid on the role of SRPK1 in cisplatin resistance(7-8). The apoptosis resistance induced by anticancer drug treatment has been suggested as another important mechanism in cellular resistance(4). More and more studies have shown that abnormal expression of long non-coding RNA (lncRNA) is involved in tumor development and progression(9). In a previous study, we obtained lncRNA UCA1 using RACE and found that higher expression of lncRNA UCA1 in bladder tumor tissues than normal tissues(10). Here, we tried to assess the expression of UCA1 and SRPK1 in ovarian cancer tissue and normal tissue using RT-PCR and explore the role of UCA1 in cisplatin induced ovarian cancer cell resistance. Our results might provide theoretical basis for chemotherapy selection in clinic and a novel cisplatin resistance related target was also suggested. Methods and materials Cell culture, Patients and Ovarian tumor specimens The human ovarian cancer cell line SKOV3 was maintained at 37 °C and 5% CO2 incubator in RPMI-1640 media with 10% fetal bovine serum, 100 U/ml penicillin, and 100  µg/ml streptomycin. Flash frozen tissue specimens (n= 40) were obtained from patients undergoing debulking surgery for ovarian cancer at People’s hospital of Shaanxi Providence, Shaanxi, China from January 2010 to January 2013. Among the specimens, epithelial ovarian cancer (n=24) were obtained from primary lesion of the patients without radiochemotherapy while normal ovarian samples (n= 16) were obtained from patients undergoing hysterectomies for benign conditions. The pathological examination on all tissues was confirmed by two experienced physician. Written consent was provided by each patient and the whole protocol was proved by the Review Board of the hospital. Reverse transcription PCR analysis Total RNA extraction of cancer tissue or cells were performed with Trizol (Life Tech, US) and the reverse transcription reaction were performed with ImProm II reverse transcriptase(Promega, US) according to the manufacturer’s instruction. UCA1, SRPK1, 18S rRNA specific sequences were amplified during 30 cycles of 30 s denaturing at 95 °C, 60 s annealing at 57 °C, and 60 s extension at 72 °C, with the primers listed in Table 1. Table 1 Primer sequences used in the study Name Forward primer Reverse primer UCA1 CTCTCCATTGGGTTCACCATTC GCGGCAGGTCTTAAGAGATGAG SRPK1 TAACGGACCACTGGACAACAAA TTCCTGCGACCACTCATACTTC 18S rRNA CAGCCACCCGAGATTGAGCA TAGTAGCGACGGGCGGTGTG UCA1 (full length) CGGGATCCTGACATTCTTCTGGACAATGAG CCGGAATTCGCATATTAGCTTTAATGTAGGTGGC Expression of UCA1 in SKOV3 cells The full length of UCA1 was expanded by PCR (The primer was showed in Table 1) at an annealing temperature of 53  °C. After digested with BamHI and EcoRI, the PCR fragment was subcloned into pcDNA3.1 to construct the pcDNA-UCA plasmid. Transient transfection of cells with plasmid was performed with Lipofectamine ® 2000 (Life Tech, US). Twenty-four hours later, G418 selection(500  µg/mL) was processed for 3 weeks. The characterization of the positive clone was confimed by RT-PCR. The pcDNA3.1 without UCA1 fragment was used as negative control. RNAi The shRNA sequences of SRPK1 were obtained according to previous description(11). SH1 and SH3, encoding shRNA targeting nucleotides 1423 to 1443 (GGTCAGTCATTCAGTGAACAA) and 288 to 308 (CAAGAAGATCCTAATGATTA), respectively, of the SRPK1 mRNA, were processed with annealing, subcloning into PRNAT-U6.1/Neo plasmid (GenScrpt Corp., Piscataway, NJ, US), plasmid expansion and media amount extraction. Transient transfection of cells with plasmid was performed with Lipofectamine ® 2000 (Life Tech, US) and 3 different batch of cells were used for knockdown efficacy examination. Stable cell lines were obtained by G418 selection for 3 weeks. The expression of SRPK1 was confirmed by western-blot analysis. Western-blot analysis The frozen myocardial tissues were lysed in RIPA buffer (Beyotime, China), followed by high speed centrifugation and BCA quantification. Cellular protein was separated by electrophoresis on SDS-PAGE gel and then transferred onto PVDF membrane. After blocking, the blots were incubated with the antibodies to SRPK1 (BD), Bcl-2 (Cell Signaling Technology), BAX (Cell Signaling Technology), caspase-3(Cell Signaling Technology), aspase-3(Cell Signaling Technology). And ÃŽ ²-Actin(Cell Signaling Technology) was used as loading control. The appropriate HPR conjugated secondary antibodies were applied. The protein bands detected with SuperSignal Ultra Chemiluminescent Substrate (Pierce) on X-ray films (Koda). MTT After preparing the single cell suspension, 4Ãâ€"103 cells in 100 ÃŽ ¼L culture media were seeded in 96-well plate in quadruplicate overnight. MTT was added for 4 hr, and formazan dye was dissolved with DMSO and read at 490 nm in a microplate reader (Molecular Device, US). All the experiments were performed for three times. Clonogenic Survival Assay Cells (5Ãâ€"102) were seeded in 6-well plates overnight and incubated with RPMI1640 + 10%FBS + 500 ÃŽ ¼g/ml G418 for 14 day. After removing the media, cells were washed with PBS, fixed with 95% ethanol for 30 min and stained with Giemsa for 15 min. Colonies with >50 cells were counted under microscope. Percentage cell survival is expressed relative to untreated control. Scratch assay 3.0Ãâ€"105 cells were seeded in 6-well plates and the cells were allowed to grow until 90% confluence was reached. Then the cells were grown in 0.2% FBS RPMI1640 media overnight for resting and a scratch was made by using the 200 ÃŽ ¼L pipette tip. The photos were taken at 0 h and 24 h under a microscopy and the relative migrating distances of the wound areas were measured on the images. 3-D migration and Invasion assay Cells (5Ãâ€"105) were seeded in triplicate in upper chamber of the Millicell (8 ÃŽ ¼m pore diameter) which was pre-coated with Matrigel (Becton Dickinson Labware, Bedford, MA). After the lower chamber of the Millicell was added with 900 ÃŽ ¼L RPMI 1640 +20% FBS, the Millicell was incubated at 37 °C and 5% CO2 for 24 hrs. Then the Matrigel was removed by cotton tip, fixed with 95% ethanol for 30 min, stained with Giemsa staining. The membrane was checked with microscopy. The migration assay was similar with invasion assay but with 12 hr incubation time. Cisplatin resistance assay Cells (3Ãâ€"104) were seeded in quadruplicate in 24-well plate and allowed to adhere overnight. Then the cells were treated with serious concentration of cisplatin(0,2.5,5,10, 20,40,80 ÃŽ ¼M) for 48 hr. Cell viability was determined by MTT assay at 490 nm wavelength. Statistical analysis All statistical analyses were performed using the SPSS13.0 software. The results were presented as means  ± SD. Two-tailed Student’s t-test was used to examine the differences between groups. P Results The expression of UCA 1 RNA and SRPK1 mRNA in ovarian tissues Twenty-four ovarian epithelial cancer tissue and sixteen normal ovarian tissue was used to assess the UCA1 and SRPK1 expression. And we found higher expression of UCA 1 RNA and SRPK1 mRNA in ovarian cancer tissue while no significant expression of UCA1 and SRPK1 was found in normal ovarian tissue(Figure 1A). The effect of UCA1 RNA expression on SKVO3 migration and invasion Cell lines establishing After constructing of pcDNA-UCA1, the stable cell lines with or without UCA1 RNA expression were established. The positive control was confirmed by RT-PCR and the result showed that a length of 1442 bp UCA1 RNA was expanded from SKOV3/pcDNA-UCA1 while no UCA1 was found in negative control SKOV3/pcDNA 3.1(Figure 1B). 2-D and 3-D Migration and invasion assay The scratch assay suggested that cell migration ability of SKOV3/pcDNA-UCA1 was significantly increased that of SKOV3/pcDNA 3.1(Figure 1C). The 3-D migration and invasion assay with millicell chamber showed that the migration and invasion abilities were significantly increased in SKOV3/pcDNA-UCA1 cell than SKOV3/pcDNA 3.1 cells(Figure 2A). Cisplatin resistance assay The cisplatin resistance assay was performed with SKOV3/pcDNA-UCA1 and SKOV3/pcDNA 3.1 cells by MTT. Increased cisplatin resistance was found in SKOV3/pcDNA-UCA1 cell. The IC50 of SKOV3/pcDNA-UCA1 cells increased 2.41 times than that of SKOV3/pcDNA 3.1 cells(Figure 2B). Western blot analysis of SRPK1 and apoptosis pathway To explore the mechanism we analyzed the expression of SRPK1, Bcl-2, Bax, Caspase3 and Caspase9 in SKOV3/pcDNA-UCA1 and SKOV3/pcDNA 3.1 cells and found that increased expression of SRPK1 and Bcl-2 and decreased expression of Bax, Caspase3 and Caspase9 in SKOV3/pcDNA-UCA1 cells (Figure 2C). The effect of SRPK1 knockdown on SKOV3 cells Knockdown cell line establishing The knockdown efficacy of pRNAT-SH1 and pRNAT-SH3 were firstly examined by transient transfestion and western-blot. And the results showed that SKOV3/ pRNAT-SH3 was extend a better effect of knocking down SRPK1 (Figure 3A1). Stable cell lines of SKOV3/pRNAT-SH3 and SKOV3/pRNAT-U6.1 were also established and the effect of pRNAT-SH3 on SRPK1 knockdown was showed in Figure 3A2. The proliferation, colongenic, migration, invasion abilities of SRPK1 knockdown The result of MTT assay was showed that decreased proliferation was found in SKOV3/pRNAT-SH3(Figure 3B). The colongenic ability of SKOV3/pRNAT-SH3 was significantly decreased than that of SKOV3/pRNAT-U6.1(Figure 3C). The 3-D migration and cell invasion assay showed that the cell migration and invasion were decreased in SKOV3/pRNAT-SH3 cells than SKOV3/pRNAT-U6.1 cells(Figure 4A). Cisplatin resistance assay The cisplatin resistance assay was performed with SKOV3/pRNAT-SH3 and SKOV3/pRNAT-U6.1 cells by MTT. Increased cisplatin resistance was found in SKOV3/pRNAT-SH3 cell. The IC50 of SKOV3/pRNAT-SH3 cells was increased 2.64 times than that of SKOV3/pRNAT-U6.1 cells(Figure 4B). Western blot analysis of SRPK1 and apoptosis pathway To explore the mechanism we analyzed the expression of SRPK1, Bcl-2, Bax, Caspase3 and Caspase9 in SKOV3/pRNAT-SH3 and SKOV3/pRNAT-U6.1 cells and found that increased expression of SRPK1 and Bcl-2 and decreased expression of Bax, Caspase3 and Caspase9 in SKOV3/pRNAT-SH3 cells (Figure 4C). Discussion The lnc RNA UCA1 was cloned in our lab using SMAT-RACE from the bladder cancer cell line BLZ-211. And UCA1 RNA showed an expression pattern of increasing expression in early stage of human embryonic development, differential expression at 28 week of embryonic development, no expression in normal adult tissues. However, the expression of UCA1 RNA was increased in bladder cancer tissues(10). In addition, the increasing expression of UCA1 RNA than the normal or para-carcinoma tissueswas also found in breast cancer, liver cancer, thyroid cancer, cervical cancer, lung cancer, esophagus cancer, gastric cancer and so on(12). We didn’t observe an obvious expression of UCA1 RNA in normal tissues and did observe the expression of UCA1 RNA in ovarian cancer tissues. This suggested UCA1 RNA may extent a critical role in the development and progression of ovarian cancer. The previous study showed that the abilities of cell proliferation, cisplatin resistance, invasion and migration were increased in bladder cancer cell line(13). Yang et al showed that UCA1 can regulate the cell cycle through CREB and PI3K pathway(14). Wang et al found that overexpression of UCA1a(also named as CUDR) in bladder cancer cells would increase the abilities of cell proliferation, invasion and cisplatin resistance and decrease cell apoptosis(15). Wing et al showed that increased expression of UCA1a could increase the cellular resistance and decrease the apoptosis in A431 squamous cancer cells. However, the mechanism is still unknown(16). The cisplatin resistance of ovarian cancer is the main cause of tumor recurrence and the failure of chemotherapy. The mechanisms of cisplatin resistance included dose accumulation of the drug, metabolism, apoptosis and DNA damage and it is a complicate process of multi-factor, multi-level and multi-gene. SKOV3 was used to assess the cisplatin resistance effect in ovarian cancer. We established SKOV3 cell lines expressing UCA1 RNA and found that cell abilities of migration, invasion and cisplatin resistance were increased, which was consistent with the results obtained from the bladder cancer cell lines. Since SRPK1 was proved to involve in the cisplatin resistance(17-18), we also tried to analyze the association between UCA1 RNA and SRPK1. And the western blot results showed that increased expression of SRPK1 and Bcl-2 while decreased expression of Bax, Caspase 3 and Caspase 9. SRPK1 is specific kinase belonged to SR family. It can specifically phosphorylate the SR splice factor and regulate the gene expression by alternative splicing of pre-mRNA of target gene(6). Hayes et al found decreased expression of SRPK1 in pancreas, colon and breast cancer could lead to increasing and decreasing expression of Bcl-2 and Bax. The decreasing on cell proliferation and increasing on cell apoptosis were found (19). Furthermore, increased sensitivities of Gemcitabine and Cisplatin were also found (11, 19). In order to confirm whether SRPK1 is involved in the mechanism of UCA1 regulating ovarian cancer proliferation and migration, we employed RNAi to decrease the expression of SRPK1 and found that increased expression of Bcl-2 and decreased expression of Bax, Caspase 3 and Caspase 9 after downregulating the expression of SRPK1. In addition, we found the increasing abilities on cell proliferation, migration and invasion after SRPK1 knockdown. In conclusion, we found UCA1 RNA may increasing of cell proliferation, decreasing apoptosis and lead to the cisplatin resistance by increasing the expression of SRPK1 and affecting the expression of apoptosis related proteins(such as Bcl-2, Bax, Caspase 3 and Caspase 9). Our results will add novel insight on cisplatin resistance and provide novel molecular target to the treatment.

Tuesday, August 20, 2019

ABCDE Approach for Critically Ill Patients

ABCDE Approach for Critically Ill Patients The topic I have chosen for my vignette is a patient with chest pain. The Resuscitation Council (UK 2006) recommends that clinical staff should follow the ABCDE approach when assessing and treating critically ill patients. This will help to identify the deterioration of critically ill patients.With this in mind, it is important that patients presenting with cardiovascular conditions are promptly assessed and treated. Here I am following an ABCDE assessment on a patient with chest pain. The 58-year-old (anonymous) male patient admitted with chest pain, 8hours after the onset of the symptoms. Initially patient was thinking it is heartburn and been taken gaviscon and paracetamol. As I went to see the patient, I introduced myself and checked identity by asking the name.Patient is able to communicate.This incates that the airway is patent. Patient is looking pale and in short of breath. Complaining of heaviness and crushing pain around the chest radiating to left arm. Sat patient upright position and checked breathing. Respiratory rate is 20bpm. (9-14bpm is normal resp rate-bts guidelines). The pattern of the breathing is normal, the movement of the chest wall is equal, and symmetrical.SaO2 checked is, 95% on room air. (Above 94%is normal or 88%-92% for those with resp problem (copd) BTS 2008).I administered 35% oxygen via venturi mask. Supplemental oxygen therapy is important to maintain adequate oxygen levels in the tissues and organs when patients experiencing pain and shortness of breath. (Critical care assessment booklet) Patients peripheries are cold and clammy.this indicates poorly perfused tissues. Pressed on patients finger for 5 seconds to check the capillary refill time.(in health,initial blanching should disappear within 2seconds of releasing pressure(Athern and Philpot 2002).CRT is 4 seconds. delayed CRT indicates poor perfusion(Lima and Bakker 2005). checked radial pulse is tachycardic 114bpm.rate is regular. A manual pulse should always checked, as machines that measure heart rate tend to give an averaged value and therefore do not pickup irregularities or arterial insufficiency (Torrance and Elley, 1997).HR is above systolic blood pressure indicating that patient having cardiac problem. Blood pressure is 101/54 mmhg, Temp 36 deg. Patient was very restless due to pain. Obtained ECG and showing small elevation in the ST segment in standard leads.ST elevation is the first sign of infarction. This happens when myocardium injured. ECG is showing Acute Myocardial infarction. Pain relief is the first priority, as uncontrolled pain increases sympathetic stimulation, which leads to increased myocardial oxygen consumption. This can further aggravate the ischemia (T Moore P Woodrow). Informed doctor about patients condition. Inserted cannula and taken bloods for troponin t and routine investigation fbc, ues, coagulation profile. Doctor arrived and examined the patient, advised to give GTN spray and Diamorphine injection (GTN generates nitric oxide that is Vasoprotective.Nitrovasodilators act primarily to dilate veins and therefore has a major effect on reducing the filling pressures of the heart. This helps to reduce myocardial contraction, wall stress, oxygen demands .It is short acting, and its effects last up to 30 minutes. The sublingual route is preferred as this avoids metabolism by the liver which reduces the drug concentration (H Chummun,KGopaul,A. Lutchman 2009) Diamorphine injection 5mg intravenously given .This is both potent analgesic and has pos itive hemodynamic effects particularly,vasodialatation which reduces the myocardial oxygen demand. Metochlorpromide 10mg intravenously (Antiemetic) given along with opiates to minimize nausea, a side effect of opiates therapy. Aspirin and Clopidogrel 300mg given .These are antiplatelet drugs ,decrease the platelet aggregation and inhibit thrombus formation in the arterial circulation ,because in faster-flowing vessels,throbi are composed mainly of platelets with little fibrin. (BNF 2010) Patient is not thrombolysed with streptokinase injection, because the late presentation and later administration is less effective outcome. Currently most protocols advocate a time window of 6hrs from the onset of pain during which it is appropriate to give thrombolytics.After this time it is usually considered that the risk of the drug outweigh the limited benefit gained(MrBassets and Mr Makins). Reassessed vital signs and pain. The pain is easing off slightly, scoring 2.respiratory rate 16bpm , HR 98bpm BP 112/68,CRT 2. Patients condition is improving. Pain assessment is a priority because continued pain is a symptom of ongoing MI, which places additional risk on myocardial tissue (Urden et al, 2002). Repeat Diamorphine injection given as advised by doctor. Closely observed the patient, monitored breathing and oxygen saturation. Oxygen therapy continued, because it is important to assist the myocardial tissue to continue its pumping activity and to repair the damaged tissue around the site of the infarct (Sole et al, 2001).No shortness of breath at present. Repeat ECG taken in 15 minutes interval for assessment of dysrhythmias and it is noninvasive, well tolerated by patients and provides continuous information about the heart (Docherty and Douglas, 2003). Patients blood sugar checked and it is 6.7mmol.patient has no diabetic history. Patient is very anxious and worried. Anxiety can play a role in acute MI. It may affect the development of further heart disease, further morbidity or prognosis, health care use and rehabilitation. (Crow et al,1996, Januzzi et al 2000).I reassured patient. Anxiety management is assigned a high priority in the early management of Acute MI. Doctor discussed with family about present condition and treatment. Family member who are anxious or upset about the patients condition may heighten patient anxiety, research suggest that family members should provide with information to meet their needs to reduce family anxiety (Quinn et al 1996).Doctor explained to the family about patients diagnosis and treatment. Heart rate monitored continuously by attaching telemetry. This helps to identify cardiac arrhythmias. Vitals signs and pain score recorded regularly. Recognizing the signs of clinical deterioration and taking appropriate timely action can be a vital part of providing optimal patient care. The clinical signs of critical illness usually reflect compromised respiratory, cardiovascular and neurological function.The underlying aim of the initial interventions should be seen as a holding measure to keep the patient alive,and produces some clinical improvement ,in order that definitive treatment may be initiated(Nolan et al,2005).

Monday, August 19, 2019

The Great Gatsby :: essays research papers

An American Dream; The inspirer.   Ã‚  Ã‚  Ã‚  Ã‚   In The Great Gatsby, but F. Scott Fitzgerald, a great man is reduced to a corpse because of a jealous lover. In the novel, the American dream is referred to time and time again. The fact that if one works hard, he or she will become rich and achieve their dreams is the notion that the American dream is based upon. In some cases this is true, but for every case where this has happened, there is a case for which it has not. For Daisy, Tom, and Gatsby, the American dream has become a way of life; spending recklessly and living an envious life.   Ã‚  Ã‚  Ã‚  Ã‚  For Gatsby, the spending on himself is not so much as great as the spending on others, in the hope to find his lost love, Daisy. By no means to Gatsby live a frugal life, but the possessions he has within his house are not as elaborate as one might think them to be. Gatsby started out as a nobody, and that was when he met Daisy. After he came out of the military, he went on a series of endeavors to become rich in a hope to win back Daisy, who had left him essentially because he could not provide what she desired. Most of the dealings that Gatsby had seemed questionable, and these suspicions were enforced by the amount of wealth he appeared to have acquired over such a short amount of time. â€Å"I was in the drug business, then I was in the oil business. But I’m not in either one now.†(Ch5, pg 95) This quotation from a conversation between Nick and Gatsby about Gatsby’s enterprises reaffirms the doubtful legality of his accomplishments. The fi rst impression of Gatsby is given by the larger-than-life house he possessed opposite that of Nick. However, the greed of Gatsby was much more selfless then that of either Daisy or Tom, because the majority of Gatsby’s spending was on elaborate parties in order to one day catch a glimpse of Daisy there.   Ã‚  Ã‚  Ã‚  Ã‚  The American dream of Daisy was no better or worse then the next person. The only difference was how she went about getting it. Owing to her immense beauty, Daisy would not have to work to achieve her American dream; she could simply attract a mate who already posses the wealth she would most readily spend. Throughout the novel, the reader is given the impression that Daisy and Tom share a happy relationship, but not more then a few times is talk of a child concerned, so it is a huge shock in the scene that Daisy beckons her child to come toward her.

Sunday, August 18, 2019

The Silver-tongued Rapist in Vladimir Nabokovs Lolita Essay -- Naboko

The Silver-tongued Rapist in Lolita    You can always count on a murderer for a fancy prose style. So says Humbert Humbert at the start of Lolita in his account to the "Ladies and gentlemen of the jury" (9). He refers to himself as a murderer (he is, after all, "guilty of killing Quilty"), not as a rapist, the far more serious offense Lolita levels at him. That I, and everyone else who reads the book, call Dolores Haze by the name "Lolita" demonstrates the efficacy of Humbert's fancy prose style - under the spell of his aesthetic mastery, we, the jury, must bend to his subjective vision through memory, and thus we see the twelve-year-old nymphet as Lolita, as she is in Humbert's arms. It is difficult to castigate Humbert when we see the world through his European eyes.    Humbert's main strength is his sense of humor. Nabokov is sure to throw Humbert's way all the American kitsch he can handle - mostly in the form of Charlotte Haze. His sly insults sail over her head, but Humbert wins our approval by making sure we understand them. Similarly, we admire him be...

The Moon :: Essays Papers

The Moon The Moon is the only natural satellite of Earth: orbit: 384,400 km from Earth diameter: 3476 km mass: 7.35e22 kg Called Luna by the Romans, Selene and Artemis by the Greeks, and many other names in other mythologies. The Moon, of course, has been known since prehistoric times. It is the second brightest object in the sky after the Sun. As the Moon orbits around the Earth once per month, the angle between the Earth, the Moon and the Sun changes; we see this as the cycle of the Moon's phases. The time between successive new moons is 29.5 days (709 hours), slightly different from the Moon's orbital period (measured against the stars) since the Earth moves a significant distance in its orbit around the Sun in that time. Due to its size and composition, the Moon is sometimes classified as a terrestrial "planet" along with Mercury, Venus, Earth and Mars. The Moon was first visited by the Soviet spacecraft Luna 2 in 1959. It is the only extraterrestrial body to have been visited by humans. The first landing was on July 20, 1969 (do you remember where you were?); the last was in December 1972. The Moon is also the only body from which samples have been returned to Earth. In the summer of 1994, the Moon was very extensively mapped by the little spacecraft Clementine and again in 1999 by Lunar Prospector. The gravitational forces between the Earth and the Moon cause some interesting effects. The most obvious is the tides. The Moon's gravitational attraction is stronger on the side of the Earth nearest to the Moon and weaker on the opposite side. Since the Earth, and particularly the oceans, is not perfectly rigid it is stretched out along the line toward the Moon. From our perspective on the Earth's surface we see two small bulges, one in the direction of the Moon and one directly opposite. The effect is much stronger in the ocean water than in the solid crust so the water bulges are higher. And because the Earth rotates much faster than the Moon moves in its orbit, the bulges move around the Earth about once a day giving two high tides per day.

Saturday, August 17, 2019

Breaking the Disney Spell Essay

Jack Zipes, in his essay â€Å"Breaking the Disney Spell†, directly addresses the issue of what happens when a story is taken from its original oral form and written down. Zipes discusses in depth what Walt Disney has done to fairy tales and the consequences of Disney’s actions. Zipes addresses many issues, including those of context, society, and alteration of plot. He accuses Walt Disney of attacking â€Å"the literary tradition of the fairy tale† (344). While many scholars disagree with Zipes’ accusations, his essay makes very solid and well-presented points that he promptly backs with fact. Regardless of what the scholars say, Zipes was right: Oral tradition is important, and Disney’s representations of historical folktales damaged fairy tales as we know them. When Walt Disney began his cartoon and film career in 1927, he might have been unaware of how the American public would rush to purchase his â€Å"original† creations. His first cartoon, a re-creation of Lewis Carroll’s Alice’s Adventures in Wonderland that added a comedic spin, began his career in the cartoon industry and eventually spun his company into a billion dollar enterprise (Funding Universe). As Disney’s popularity grew, he continued to expand his film creations, but generally by copying or â€Å"re-creating† fairy tales or other historical literature. Many Americans believe that Walt Disney was the first person to create fairy tales, and Disney failed to recognize the original creators of the stories that made him so popular: the folk. Historically, fairy tales were told amongst people that historians and folklorists refer to as â€Å"the folk. † That is, the stories were shared orally, in what is commonly referred to as â€Å"sacred space† (Curry). Fairy tales were not intended to be read alone, in silence. Rather, they were created to be shared in a group of people, and, while fairy tales were saturated with meaning, that meaning could vary based on the storyteller. Fairy Tales were also often the holders of a warning or admonition that could be adjusted depending on the listener. One mother might have told her daughter one version of â€Å"Cinderella† in order to make a statement about her daughter’s life, whereas another mother might have told a completely different version of the same story. This, Zipes argues, is what made fairy tales unique and important. He comments, â€Å"A narrator or narrators told tales to bring members of a group or tribe closer together and to provide them with a sense of mission† (332). Fairy tales were told from an older generation to a younger generation. As mentioned previously, they were not shared in private, by oneself, alone with a book or videotape. Zipes comments, â€Å"This privatization violated the communal aspects of the folk tale† (335). The stories were a collective form of communication that occurred in a group setting, in a safe place, in a sacred space. Fairy tales, besides communicating moral and social messages, were a rite of passage. Martha C. Sims and Martine Stephens, both revered folklorists, make a statement about the importance of storytelling and teaching in their book Living Folklore. â€Å"Rites of passage mark notable dates or stages in a person’s life. Most rites of passage occur at times of change or transition: birth, puberty, entering adulthood or coming-of-age, marriage, and death, for example† (110). Fairy tales were used in rites of passage as a way to communicate with the younger generation about the changes that take place during puberty, adolescence, and marriage. Even in the written versions of Fairy Tales produced by the Brothers Grimm, Perrault, and other respected folklorists, scholars are able to grasp and to understand the importance of various elements that are present in the stories that show valuable truth about life adjustments and growing up. Many folklorists, however, consider Disney’s version of historical fairy tales to have stripped them of their meaning. Zipes is one of them. Zipes uses the example of Disney’s recreation of Puss in Boots to show that Disney altered the story to â€Å"use it as a self-figuration that would mark the genre for years to come† (343). Zipes argues that Disney changes the protagonist of the story from Puss to the â€Å"young king. † In the original version of the tale, the cat was the hero and the young boy he was friends with played a minor role in the tale. The boy in the original tale was not royalty at all: he was a commoner. Disney changed both the importance of the boy’s role in the story, as well as his social status. By adjusting the story, Zipes declares that Disney projected his own self into the story and presented it in a sort of auto-biographical fashion. Disney saw himself as the young king and projected that into the story. Disney did not see himself as simply an ordinary commoner: he was far above the peasant class, at least in his own mind. While many of Disney’s fans and viewers may argue that his recreation of fairy tales made little to no impact on the original meaning, Zipes believes otherwise. â€Å"Disney’s film is also an attack on the literary tradition of the fairy tale. He robs the literary tale of its voice and changes its form and meaning† (344). Disney not only adjusts the main elements of a story, but he also alters the point of view and the narrator, as we see in Puss in Boots. Instead of the story being told from Puss’ point of view, the â€Å"hero† of the story is the young boy. In Disney’s other fairy tale recreations, he often adds characters and makes them the hero or savior of the story. Often, instead of being told by a female point of view and being about women, as many fairy tales are historically represented, Disney projects a patriarchal view on the story and makes it obvious to his viewers that a woman’s life is meaningless without a man to guide her. Disney’s characters all understand the importance of waiting around for their prince to arrive and â€Å"save them† from the life that they so torturously endure. Instead of the bright, intelligent, and witty women that are evidenced in such tales as Italo Calvino’s The False Grandmother and Lasair Gheug, the King of Ireland’s Daughter, Disney’s heroines appear to be lacking not only spine, but brains as well. Many American children have grown up completely unaware that the concept of a prince saving a princess is a distinctly Disney idea. The classic fairy tales often involve feminine strength and an urging of women to be able to outsmart her predators. If a girl is not able to outsmart her attacker, she is simply killed. This is evidenced quite well in Perrault’s Little Red Riding Hood and the Brothers Grimm tale of Little Red Cap. A comparison of the two stories will bring to light the idea that if a young girl is smart enough, she can outwit any predator – even a hungry wolf. The girl in Little Red Cap is able to do just that, and escapes with her life. Contrarily, the heroine of Little Red Riding Hood is not quite clever enough, and she is â€Å"gobbled up† (Perrault 13). The concept of women needing a savior is quite obvious in the Disney version of Snow White. Zipes notes, â€Å"Snow White was his story that he had taken from the Grimm Brothers and changed completely to suit his tastes and beliefs. He cast a spell over this German tale and transformed it into something peculiarly American† (346). Maria Tatar also notes the impact of Disney’s version on the American public as she comments, â€Å"Walt Disney’s Snow White and the Seven Dwarfs has so eclipsed other versions of the story that it is easy to forget that hundreds of variants have been collected over the past century in Europe, Asia, Africa, and the Americas† (74). In the oldest versions of Snow White, the heroine of the story does not need to be â€Å"saved† by a prince. The Brothers Grimm depict Snow White coming back to life by her coffin being jarred, which dislodged the apple in her throat (Grimm 89). Similarly, in the Lasair Gheug version of this tale, it is the king’s new wife who saves Snow White by picking the ice out of her forehead and palms (94). Disney, however, shows Snow White as a weak female who must be rescued by her â€Å"prince Charming. † She is saved, not by accident or by a minor character, but â€Å"when the prince, who has searched far and wife for her, arrives and bestows a kiss on her lips. His kiss of love is the only antidote to the queen’s poison† (Zipes 348). Disney’s portrayal of princesses or young girls as weak and frail leads Zipes to believe that Disney â€Å"perpetuated a male myth† which is, subconsciously, a celebration of his own destiny and success (348). Disney, although his primary characters are nearly always female, depicts them as weak and needy. It is only the secondary male character and the antagonist female in Disney’s stories who appear to have spines. By keeping his primary female characters weak, Disney is sending the message that women are helpless without men. Zipes, in accordance with this idea, notices that not only are the primary females in Disney’s stories kept weak, but that the male â€Å"heroes† of his tales are overly masculine and are the saviors of the stories. â€Å"In this regard,† notes Zipes, â€Å"the prince can be interpreted as Disney†¦ Snow White cannot be fulfilled until he arrives to kiss her†¦ † (349). Zipes argues that Disney, in his creation of weak females and strong male heroes, is making a statement that he, Disney, is a hero. Disney’s re-telling of these fairy tales is not simply adding his own perspective to the issue at hand. Rather, Disney completely rewrites fairy tales to mean what he wants them to mean. Most historical fairy tales have a common theme and moral in them, regardless of the story teller. From Perrault to the Brothers Grimm, much retelling is similar, with only slight variances. Disney, however, with his addition of â€Å"him† to the story, alters the story not only by point of view, but also in it’s moral and its core message. Some folklorists argue that a recreation and revision of historical folklore is necessary to ensure that the current generations retain their interest in the past. Many might argue that Disney’s retelling of fairy tales has not harmed the historical value of the stories. Benjamin Filene makes this argument in his work Romancing the Folk. â€Å"†¦ the backward glance can be more than nostalgic — that memory can create American culture anew† (236). While Filene may truly believe that it is important to incite interest in folklore amongst the youth of the current generation, Zipes disagrees. His research leads him to believe that this alteration, whether for personal gain or simply for popularizing any type of folklore, permanently hinders the message that is inherently present in the original version. Disney, in his new representations of fairy tales, loses sight of the original messages and completely removed the moral and meaning from the stories. Zipes, in Breaking the Disney Spell, provides clear evidence that Disney has violated the sanctity of fairy tales by rewriting them for his own personal pleasure and gain. By projecting himself into the fairy tales, Disney not only removes the moral message of the story, but also replaces the matriarchal values with patriarchal ones. Disney molds women to meet his standards of how women should behave, rather than portraying the strong and clever females that are visible in the original tales. While fairy tales were altered when they became a written tradition rather than an oral one, most stories still maintained their original moral values. Disney, however, strips the stories even of that in lieu of something â€Å"better†: his own pleasure and fame. After Disney, fairy tales will never be the same. Now, society is stuck with his egotistical creations that are beneficial to no one but himself. Instead of the stories being meaningful and a rite of passage, they are reduced to simply a meaningless tale of Disney’s life and goals. Zipes was right: Disney has damaged fairy tales and they will never be quite the same

Friday, August 16, 2019

Leave This Chanting

Gitanjali is a collection of 103 English poems, largely translations, by the Bengali poet Rabindranath Tagore. ‘Leave this chanting’ is the 11th poem in the collection. The poet advises the priests to give up their counting of beads and their singing and chanting of mantras. He also urges them stop the worship of God in a secluded corner of the temple, with their eyes half shut. He sharply states, ‘Open your eyes and see God is not there before you. ’ God is not to be found in this way.God lives with the humble and down-trodden like the tillers of the land and path-makers who work hard at breaking stones. He lives with those who toil in sun and shower and whose clothes are soiled with dust. If the priest wants God he must come out of his temple, give up his holy robes and work with the humble tillers of the soil in rain and sun. Tagore thus glorifies the life of the humble labourers and rejects the ascetic way of life. The ultimate spiritual goal of the asce tic is to seek deliverance.This is the liberation of the soul from the cycle of birth and death. But God Himself is bound to all of us in chains of love. He himself is not free and He has joyfully bound Himself to the work of creation and to the objects He has created. How can then man ever hope to be free from bondage? He urges the ascetics to leave the ritualistic flowers and incense which does not serve any purpose. According to the poet one can find God not in the temple but with the workers who are working whole day in the dirt and under the hot sun.He asks us what harm is there if you work under the sun and if your clothes become dirt. Even when your clothes are turn out or stained there is no harm because one is going to see the creator. Thus Tagore conveys that participation in the activity of life is essential for the realization of God. This poem ‘Leave This Chanting’ is equally important in World Literature due to his exposing the pseudo-zeal of worshippers e verywhere.

Thursday, August 15, 2019

Immortality

Possibly one of the greatest achievements in life is to attain immortality. Generally, immortality means being able to have eternal life or sustain life for an infinite amount of time. However, for a lot of people, the word can have different meanings if it is viewed from various perspectives. For soldiers or heroes of war, the only way to attain immortality is through fighting in the battlefield. However, contrary to the purpose of immortality which is to sustain life, for soldiers or heroes of war, death is another way to become immortal. Basically, more than receiving honor and glory after a battle or a war, it is also important for soldiers to be remembered. And for some, the best way to do this is to die honorably. Dying in the battlefield makes soldiers heroes almost instantaneously as they are given medals and other posthumous recognitions. Although they are no longer alive, the names and accomplishments of the soldiers who die valiantly and honorably are always glorified and in effect, this makes them immortal. In other words, soldiers who die in battle become immortal as their names are forever imprinted in history. On the other hand, other people believe that immortality can only be attained if they remain young. In this aspect, the concept is that if one stays young, he or she will not acquire age-related diseases or sicknesses which could cause his or her death. While there are a lot of methods and ideas being used to preserve one’s youth, most of them only have temporary effects. For example, one of the most conventional methods to stay young is exercising as studies show that this promotes good circulation of the blood in the body which subsequently results in good health. Although this method does not make a person immortal, it sustains his or youth for a short period of time. However, aside from conventional methods, some people believe that one way to attain immortality is through supernatural or magical means. One example is the legendary fountain of youth which is a spring that restores the youth of any person who drinks from it and is believed to be located in Florida. While modern day society has dismissed the existence of this fountain, certain people still believe in its youth-restoring effects and even drank the water themselves. Moreover, according to the basic concepts of most religions, people are immortal as they possess in them souls or spirits, which never cease to exist. For example, in Buddhism, one of the strongest beliefs is that people go through a cycle of birth, death, and rebirth. Although Buddhists believe that there is no such a thing as an eternal soul, they still believe that after biological death, a person will still continue to live and attain eternal happiness. On the other hand, in Christianity, the strongest belief regarding immortality is that everyone who dies will eventually be resurrected depending on the â€Å"Final Judgment† of God. Based on this belief, those who are born again after the â€Å"Final Judgment† will live forever or attain immortality. However, for other people, one sure way to attain immortality is to publish a book. Whether it’s a novel, an autobiography, a reference material, the authors of these books can attain immortality as their thoughts and ideas are printed and read by people from all over the world. Even if these authors die, they will still continue to live on through their ideas and stories that have been published in their respective books. Furthermore, for some people, attaining immortality is simply being the first in accomplishing extraordinary feats. For example, Edmund Hilary, who recently died due to a heart attack, became immortal because he was the first to successfully climb Mount Everest. In reality, Hilary was an ordinary person. However, since he was the first to conquer the world’s tallest mountain, he was able to imprint his name in history books and attain immortality. Another venue to attain immorality is sports. In the world of basketball, Michael Jordan was able to achieve immortal status by being named â€Å"the greatest basketball player of all time† by the National Basket Association (NBA). Aside from his legendary stint in the NBA, Jordan has also become a highly successful brand name. Up to his day, kids and even professional basketball players from all over the world continue to idolize Jordan, which further solidifies his immortality. Furthermore, in sports, height is also another way of attaining immortality. In basketball, aside from his superb talents and numerous accomplishments, Magic Johnson is also remembered as the tallest point guard to ever play the game. On the other hand, Shawn Bradley is the tallest player to every play the game. Although in terms of accomplishments, Johnson outweighs Bradley, both their names are already imprinted in history books simply because of their heights. In this regard, fame is also another way of attaining immortality. Like in the case of Jordan, famous people such as rock stars, professional athletes, and actors, among others, are able to attain immortality by simply showcasing their skills and talents in their respective fields or specialties. However, for some, immortality is attained by simple passing on objects, lessons, and other things to younger generations. For example, a father has already attained immortality if he is able to pass on good values to his children, who in turn, pass on the lessons they have learned to their children. Even if the father dies, he will continue to live on through the lessons that he has passed on to his children. In short, immortality is not simply through prolonging life. It can also be achieved if one passes on memories, legacies, and lessons to future generations.

Wednesday, August 14, 2019

Protect Our Mother Nature

PROTECT OUR MOTHER NATURE Repeatedly in history, conceptions of nature have served as ideological justifications for political theory. The most obvious example is the Hobbesian state of nature against which even the most oppressive government appears perfectly legitimate. Whereas in most cases of political theory, nature looks like an incompetent savage or unreliable tramp, some anarchist lines of argument instead offer versions of nature as infinite, loving, or otherwise better than the artifices to which it is implicitly opposed.Whether for or against nature, depictions of the natural world in political theory consider it in cultural units of meaning, a combination of icons and stereotypes that change not only our understanding of nature, but also of the units of meaning being referenced. In the early twentieth century journal Mother Earth, a construction of nature comes together, in a publication interested mostly in anarchist and feminist goals, that worshipped nature as a huge, consuming, feminine super being.Certain traits in the construction of nature in this journal form an account of nature as a particular type of femininity to be admired, a move laden both with direct strategic value and creeping implications for the idealizations of womanhood. In order to establish the desirability of the journal’s goal of a world without artificial systems of control, the opposition of nature and artifice is a crucial first step. While it may seem tempting to define these terms, this neglects the primary function of both as catchalls with nebulous referents and amorphous structure defined only by their opposition to one another.The process of dividing the categories begins in the very first issue of the publication, in the foundational article †Mother Earth†. The article mythologizes that â€Å"Man issued from the womb of Mother Earth †¦ out of his efforts there arose the dreary doctrine that he was not related to the Earth, that she was but a temporary resting place for his scornful feet and that she held nothing for him but temptation to degrade himself. † This creation story of the present political situation clearly opposes the natural, which was original, to the artificial, which is only an egoistic and recent edifice.Nature as mother, of course, means artifice must be opposed, and thus becomes child, making the entirety of the anarchist argument parallel to motherly chastisement. In the same issue, â€Å"Without Government† bemoans government solutions as inevitably late and insubstantial, suggesting an analogy with illness where â€Å"the symptom of the disease was hidden† and only on its appearance would the government act. In this metaphor, artificial solutions to the world’s problems are only attacks on a flurry of symptoms as they slowly manifest themselves in increasingly visible ways, thus the profound animosity the journal expresses towards ‘Comstockery’.Regulation of sexuality becomes a direct example of the child trying to limit what mother had given to her children. Volume three number five offers an analogy for group resistance of bees on a tree branch, â€Å"it is only needful that one bee spread its wings, rise and fly, and after it the second, the third, the tenth, the hundredth, for the immobile hanging mass to become a freely flying swarm of bees. † The writing makes humans already bees in a thoroughly naturalized world upon which systems of domination such as the state and religion have only been imposed in a superficial sense.All we need to do, in this account, is realize the situation, and spread our wingsto fly back into an expansive and beautiful nature. This fetishization of nature provides a clear contrast between the world of that which the anarchafeminist politics of the publication oppose and the ‘real’ world of nature that underlies and surrounds the injustices of artificial living. The question then bec omes, in order to prove the insufficiency and downright failures of artifice by comparison, what is the character of nature? To begin with, nature is big.In the first issue’s article â€Å"Mother Earth†, the history of the world seems laid out in a quasi-mythical tale. â€Å"Earth was but one of a myriad of stars floating in infinite space. † The whole of the universe, with which nature remains implicitly identified, exceeds our abilities to measure, let alone comprehend – a myriad in infinity. Even in this cosmic understanding, that which is natural and surrounded is still itself huge. In an article in the first issue called â€Å"Try Love†, the argument concludes, â€Å"Let us be broad and big. Let us not overlook vital things, because of the bulk of trifles confronting us. The natural is large; problems from artifice can be numerous, but each is only of trifling size – thousands of children surrounding one huge mother. Beyond being large to begin with, the maniacal focus in the publication on freeing nature and being freed into nature also revolves around a hope for future growth. As if ‘we’ were already failing to be â€Å"broad and big† enough, â€Å"The Tragedy of Women’s Emancipation† proclaims: â€Å"Salvation lies in an energetic march onwards towards a brighter and clearer future. We are in need of unhampered growth out of old traditions and habits† as if nature and life in nature knew no limits.The image is of not just a sprouting weed, but a whole forest growing out of a street. This rhetorical strategy of associating the concept of nature so crucial to driving the arguments of the journal with hugeness seems strangely sympathetic with and to industrializing urges of the time. The conflict between the temptations of big machines with big outputs and direct material gain versus little anarchic communities with little to offer but some vague sense of satisfaction can finally be resolved in an anarchy run by a big nature figure, a loving cow mother replaces the cruel leviathan father.This solution gives all the benefits and reassurance of something so-big-it-must-work and avoids all the downfalls readers would consider so endemic to ‘modernization’ . Beyond simple scale, nature is inescapable. While a big nature appeals to childlike demand for an oversized mother who will ensure safety and grant all desires, the journal also shows nature as generally inevitable. Relying on one of many references to scientific certainty, â€Å"Liberty†, in the second volume, issue number three, reminds us: â€Å"the natural law of a social organism is as certain as, though less known than, the force of gravity.Like the latter it antedates, and is independent of, our knowledge of its existence, or of the law of its operation. † The natural law, suggesting the order inherent in ‘free’ ways of life, does not even need to be pro ven preferable to artificial laws so long as it is inevitable, the rhetoric suggests. No matter how much one tries to fight it, they can only impede the natural order of things, but never change it. Indeed, this sentiment, in argument form, makes up the bulk of the rest of the article. The natural law not only frames what is and is not tyranny, but even ‘proves’ the futility of passing any laws through the government.And men, brought up in law-abiding communities in the deepest respect for the law, will, under the changed conditions of life, not merely condone the infliction of a penalty in excess of that provided by law, but will themselves assist, virtuously satisfied with their conduct because the society of which they form a part has decided that horse-stealing shall be so punished. On the other hand, there are numerous laws on the statute books, still unrepealed and unenforceable because the acts treated of are no longer held to be offences against morality.In othe r words, the morals of a people can be regulated only by themselves. The trick is very simple, if a law is natural there is no reason to legislate about it, and if it is not natural no one will obey it. The rhetorical construction of nature as unavoidable already renders artifice more than avoidable – it is always already avoided. Rhetorical implications become argument: it would be impossible to describe any part of government’s power as belonging to government itself, because people only act based on nature. The closest government comes to legislation in this model is to prescribe behavior people already exhibit.The gist of this construction of nature is most clear in the case of a poem in volume three, number two entitled â€Å"The King†. In it, a dead king rots in nature, covered in lizards and â€Å"vile spineless things†, literally consumed by the overpowering feminine in his afterlife. â€Å"Faith lit his pathway with her loveliness; / Fair Hopeâ €™s voice called him from his barren fen; Love vainly strove to lure him with her grace. † As a feminine entity, nature is here the omnipresent mother, she tracks down her children and is always there for them to return to.Inescapable nature not only sets up a comparison in which government and artifice can never win, but simultaneously constructs the role of a feminine presence that is ineradicable and impossible to resist. The good mother must be always present and forever accepting of even her most lost children. Also, nature has youthful beauty. In the first issue of Mother Earth, the flagship article explains the history of nature in terms that make Earth unmistakably a young mother, â€Å"she renewed herself, the good mother, and came again each Spring, radiant with youthful beauty, beckoning her children to come to her bosom and partake of her bounty. Nature’s youth not only implies a relative trait against which all human-made construction can never appear more – almost sexually – attractive. The attempt to make nature look nice is nowhere so transparent as in this attempt to cast it as actually young and beautiful. Indeed, even its temporary failings can be excused by Earth’s renewal each spring. If some part of nature is dangerous or undesirable, it will soon be corrected in the regular course of the seasons. In volume five, number six, â€Å"The Esthetic Side of Jewtown† explains,Life is too strenuous in Jewtown to preserve the bloom of youth. Among the younger ones there are some who are very beautiful beneath their coating of filth, with the clove skin and large, soft, black eyes. They give themselves a coquettish appearance. The truly horrid part of life in the Ghetto, we learn, is that it covers or takes away the natural beauty of women. Artifice cannot destroy nature, because nature is big and inescapable, but it can blemish its beauty temporarily.This identification of nature with youth and beauty combined with the opposition of nature and the state sell anarchism almost exactly the way one might sell diet soda: government is actually too ugly to appreciate, gorgeous young women prefer anarchy. In classic advertising style, Mother Earth also describes nature as saturated with love. In the first issue, when describing a budding relationship crushed by the coldness of artifice and modern living, â€Å"The Tragedy of Women’s Emancipation† explains that â€Å"poetry and the enthusiasm of love cover their blushing faces before the pure beauty of the lady. Her admirer] silences the voice of his nature and remains correct. † The article condemns his correctitude as exactly the basic problem of modern living – its disconnect from love and contact. Tragically, the beauty of the lady, just as that of the kindly mother Earth, has been tainted to block the â€Å"poetry† and â€Å"enthusiasm of love† the article considers natural. In contrast to t he authentic state of love the various ‘systems’ of which anarchism complains give us poor simulations of affection: marriage and the nuclear family.In volume 3, number five, the article â€Å"Light and Shadows in the Life of an Avant-Gard†, we learn The poor women, thousands of them, abused, insulted, and outraged by their precious husbands, must continue a life of degradation. They have no money to join the colony in Reno. No relief for them. The poor women, the slaves of the slaves, must go on prostituting themselves. They must continue to bear children in hate, in conflict, in physical horror. The marriage institution and the â€Å"sanctity of the home† are only for those who have not the money to buy themselves free from both, even as the chattel slave from his master.Nature offers real love, civilization offers a slavery titled love. These stark terms of opposition function to set up an understanding of a loving motherly nature that makes it obviousl y superior to the uncaring childlike cruelties that comprise the artificial world. As is often thought, nature is also connected with freedom. It is quite arbitrary to say that those things to which a life in ‘nature’ is conducive represent the content of freedom. For instance, in nature one is not free to vote or go to work, and yet this is considered irrelevant to questions of liberty.In volume two, number three, of Mother Earth, the article â€Å"Liberty† proclaims that â€Å"whatever may be the form of social institutions, if it does no more than to declare and enforce well-known rules of natural justice, then I am free. † The simplistic opposition between the compromises of ‘artificial’ life and the freedom of nature is best exemplified in the pithy quote â€Å"Liberty escaped into the wilderness† from the journal’s founding article. This unbounded freedom seems excessively unrealistic as a description of a mother, and yet i t is precisely the freedom that mothers lacked that the journal constructs nature as having in spades.At the same time, the infinite youth, beauty, and inescapable freedom in and of nature primarily complement its fundamentally orderly state. Perhaps in one of the most bizarre fixations of anarchist literature, the journal seems careful to point out the extreme orderliness of life in anarchy. In this kind of reconciliation of total freedom and total justice one can actually see the neurosis of liberalism tentatively suggest what it most wishes simply come true: good freedom and good order. The very first issue, in the rticle â€Å"Without Government† we are told that, there are qualities present in man, which permit the possibilities of social life, organization, and co-operative work without the application of force. Such qualities are solidarity, common action, and love of justice. To-day they are either crippled [sic] or made ineffective through the influence of compulsion ; they can hardly be fully unfolded in a society in which groups, classes, and individuals are placed in hostile, irreconcilable opposition to one anotherAgain, like an orderly housewife, nature maintains a world that works, but without even so much as a broom. Instead, nature works through qualities always already present in people, as natural beings. It is through this sort of argument that anarchism can define government into such a position that it doesn’t even make sense to consider, having already had all its greatest advantages stolen over to the side of nature. Simultaneously, nature’s great assets will be willingly sacrificed to her children in cheerful martyrdom.Like the constructed role of a ‘good mother’, nature â€Å"sees the bleeding feet of her children †¦ hears their moans, and she is ever calling to them that she is theirs† beginning in the founding article of Mother Earth. The article continues to encourage the exploitation of nature because nature is asking for it, here with increasingly vivid maternal imagery. Mother Earth keeps sources of vast wealth hidden within the folds of her ample bosom, extended her inviting and hospitable arms to all those who came to her from arbitrary and despotic lands–Mother Earth ready to give herself alike to all her children.But soon she was seized by the few, stripped of her freedom, fenced in, a prey to those who were endowed with cunning and unscrupulous shrewdness. The rapaciousness of artifice and modern civilization becomes its primary characteristic when put in the terms of a kindly mother fallen prey to vicious quasi-Oedipal domination. Here, again, the journal’s construction of nature as feminine serves the direct political function of discrediting political opponents such as the state, capitalism, and religion.However, the indirect effect of such a construction may be more historically significant, as the natural world becomes increasingly femini zed in particular ways. It is impossible to simply associate nature with feminine, because there is too much to each category. Here the generality is retained on the term of nature – to the degree that it’s distinction from artifice can be kept plausible – and specificity is given to the feminine. Mothers should, in this account, sacrifice everything to their children, no matter how abusive they may be to her.Indeed, every praised trait of Mother Earth is a thinly veiled suggestion for mothers to fulfill. That Mother Earth is huge, inescapable, free and orderly says, at some level, that all good mothers are this way. Thus we end with a political theory laid out in Mother Earth that various artificial systems are bad because they are inferior to a young, beautiful martyr of an omnipresent loving mother who provides both freedom and order.In conclusion, the journal Mother Earth deployed rhetoric in various forms to craft a particular feminine version of nature tha t explicitly worked to delegitimize particular systems of oppression and implicitly functioned to worship an ideal maternal version of womanhood. The journal’s preoccupation with issues of concern to women, such as marriage, prostitution, birth control, and sexuality coincided with its normalizing urge to encounter (some) people as children of nature who could frolic freely within the limitless provisions of their mother’s great world.However, there are actually two possible roles for a subject here, children or mother herself. Politics and men immediately appear infantilized against the mother of nature, supplying a ready-made excuse and index for predicting their actions as irresponsible yet lovable children, but for many women Mother Earth was not their mother, but to be their role model.Nature was a mother whose private sphere expanded to one large planetary home and material limitations in age and restriction were erased by scientific appeal (and pure fiat) to ren der life in nature simultaneously completely free and problem-free. As a solution to the troubles of political theory, the journal instead invented a superhero character to replace the tired images of a drudging, used up, and insensitive nature with a glossy new young, beautiful cover girl – Mother Earth. Protect Our Mother Nature PROTECT OUR MOTHER NATURE Repeatedly in history, conceptions of nature have served as ideological justifications for political theory. The most obvious example is the Hobbesian state of nature against which even the most oppressive government appears perfectly legitimate. Whereas in most cases of political theory, nature looks like an incompetent savage or unreliable tramp, some anarchist lines of argument instead offer versions of nature as infinite, loving, or otherwise better than the artifices to which it is implicitly opposed.Whether for or against nature, depictions of the natural world in political theory consider it in cultural units of meaning, a combination of icons and stereotypes that change not only our understanding of nature, but also of the units of meaning being referenced. In the early twentieth century journal Mother Earth, a construction of nature comes together, in a publication interested mostly in anarchist and feminist goals, that worshipped nature as a huge, consuming, feminine super being.Certain traits in the construction of nature in this journal form an account of nature as a particular type of femininity to be admired, a move laden both with direct strategic value and creeping implications for the idealizations of womanhood. In order to establish the desirability of the journal’s goal of a world without artificial systems of control, the opposition of nature and artifice is a crucial first step. While it may seem tempting to define these terms, this neglects the primary function of both as catchalls with nebulous referents and amorphous structure defined only by their opposition to one another.The process of dividing the categories begins in the very first issue of the publication, in the foundational article †Mother Earth†. The article mythologizes that â€Å"Man issued from the womb of Mother Earth †¦ out of his efforts there arose the dreary doctrine that he was not related to the Earth, that she was but a temporary resting place for his scornful feet and that she held nothing for him but temptation to degrade himself. † This creation story of the present political situation clearly opposes the natural, which was original, to the artificial, which is only an egoistic and recent edifice.Nature as mother, of course, means artifice must be opposed, and thus becomes child, making the entirety of the anarchist argument parallel to motherly chastisement. In the same issue, â€Å"Without Government† bemoans government solutions as inevitably late and insubstantial, suggesting an analogy with illness where â€Å"the symptom of the disease was hidden† and only on its appearance would the government act. In this metaphor, artificial solutions to the world’s problems are only attacks on a flurry of symptoms as they slowly manifest themselves in increasingly visible ways, thus the profound animosity the journal expresses towards ‘Comstockery’.Regulation of sexuality becomes a direct example of the child trying to limit what mother had given to her children. Volume three number five offers an analogy for group resistance of bees on a tree branch, â€Å"it is only needful that one bee spread its wings, rise and fly, and after it the second, the third, the tenth, the hundredth, for the immobile hanging mass to become a freely flying swarm of bees. † The writing makes humans already bees in a thoroughly naturalized world upon which systems of domination such as the state and religion have only been imposed in a superficial sense.All we need to do, in this account, is realize the situation, and spread our wingsto fly back into an expansive and beautiful nature. This fetishization of nature provides a clear contrast between the world of that which the anarchafeminist politics of the publication oppose and the ‘real’ world of nature that underlies and surrounds the injustices of artificial living. The question then bec omes, in order to prove the insufficiency and downright failures of artifice by comparison, what is the character of nature? To begin with, nature is big.In the first issue’s article â€Å"Mother Earth†, the history of the world seems laid out in a quasi-mythical tale. â€Å"Earth was but one of a myriad of stars floating in infinite space. † The whole of the universe, with which nature remains implicitly identified, exceeds our abilities to measure, let alone comprehend – a myriad in infinity. Even in this cosmic understanding, that which is natural and surrounded is still itself huge. In an article in the first issue called â€Å"Try Love†, the argument concludes, â€Å"Let us be broad and big. Let us not overlook vital things, because of the bulk of trifles confronting us. The natural is large; problems from artifice can be numerous, but each is only of trifling size – thousands of children surrounding one huge mother. Beyond being large to begin with, the maniacal focus in the publication on freeing nature and being freed into nature also revolves around a hope for future growth. As if ‘we’ were already failing to be â€Å"broad and big† enough, â€Å"The Tragedy of Women’s Emancipation† proclaims: â€Å"Salvation lies in an energetic march onwards towards a brighter and clearer future. We are in need of unhampered growth out of old traditions and habits† as if nature and life in nature knew no limits.The image is of not just a sprouting weed, but a whole forest growing out of a street. This rhetorical strategy of associating the concept of nature so crucial to driving the arguments of the journal with hugeness seems strangely sympathetic with and to industrializing urges of the time. The conflict between the temptations of big machines with big outputs and direct material gain versus little anarchic communities with little to offer but some vague sense of satisfaction can finally be resolved in an anarchy run by a big nature figure, a loving cow mother replaces the cruel leviathan father.This solution gives all the benefits and reassurance of something so-big-it-must-work and avoids all the downfalls readers would consider so endemic to ‘modernization’ . Beyond simple scale, nature is inescapable. While a big nature appeals to childlike demand for an oversized mother who will ensure safety and grant all desires, the journal also shows nature as generally inevitable. Relying on one of many references to scientific certainty, â€Å"Liberty†, in the second volume, issue number three, reminds us: â€Å"the natural law of a social organism is as certain as, though less known than, the force of gravity.Like the latter it antedates, and is independent of, our knowledge of its existence, or of the law of its operation. † The natural law, suggesting the order inherent in ‘free’ ways of life, does not even need to be pro ven preferable to artificial laws so long as it is inevitable, the rhetoric suggests. No matter how much one tries to fight it, they can only impede the natural order of things, but never change it. Indeed, this sentiment, in argument form, makes up the bulk of the rest of the article. The natural law not only frames what is and is not tyranny, but even ‘proves’ the futility of passing any laws through the government.And men, brought up in law-abiding communities in the deepest respect for the law, will, under the changed conditions of life, not merely condone the infliction of a penalty in excess of that provided by law, but will themselves assist, virtuously satisfied with their conduct because the society of which they form a part has decided that horse-stealing shall be so punished. On the other hand, there are numerous laws on the statute books, still unrepealed and unenforceable because the acts treated of are no longer held to be offences against morality.In othe r words, the morals of a people can be regulated only by themselves. The trick is very simple, if a law is natural there is no reason to legislate about it, and if it is not natural no one will obey it. The rhetorical construction of nature as unavoidable already renders artifice more than avoidable – it is always already avoided. Rhetorical implications become argument: it would be impossible to describe any part of government’s power as belonging to government itself, because people only act based on nature. The closest government comes to legislation in this model is to prescribe behavior people already exhibit.The gist of this construction of nature is most clear in the case of a poem in volume three, number two entitled â€Å"The King†. In it, a dead king rots in nature, covered in lizards and â€Å"vile spineless things†, literally consumed by the overpowering feminine in his afterlife. â€Å"Faith lit his pathway with her loveliness; / Fair Hopeâ €™s voice called him from his barren fen; Love vainly strove to lure him with her grace. † As a feminine entity, nature is here the omnipresent mother, she tracks down her children and is always there for them to return to.Inescapable nature not only sets up a comparison in which government and artifice can never win, but simultaneously constructs the role of a feminine presence that is ineradicable and impossible to resist. The good mother must be always present and forever accepting of even her most lost children. Also, nature has youthful beauty. In the first issue of Mother Earth, the flagship article explains the history of nature in terms that make Earth unmistakably a young mother, â€Å"she renewed herself, the good mother, and came again each Spring, radiant with youthful beauty, beckoning her children to come to her bosom and partake of her bounty. Nature’s youth not only implies a relative trait against which all human-made construction can never appear more – almost sexually – attractive. The attempt to make nature look nice is nowhere so transparent as in this attempt to cast it as actually young and beautiful. Indeed, even its temporary failings can be excused by Earth’s renewal each spring. If some part of nature is dangerous or undesirable, it will soon be corrected in the regular course of the seasons. In volume five, number six, â€Å"The Esthetic Side of Jewtown† explains,Life is too strenuous in Jewtown to preserve the bloom of youth. Among the younger ones there are some who are very beautiful beneath their coating of filth, with the clove skin and large, soft, black eyes. They give themselves a coquettish appearance. The truly horrid part of life in the Ghetto, we learn, is that it covers or takes away the natural beauty of women. Artifice cannot destroy nature, because nature is big and inescapable, but it can blemish its beauty temporarily.This identification of nature with youth and beauty combined with the opposition of nature and the state sell anarchism almost exactly the way one might sell diet soda: government is actually too ugly to appreciate, gorgeous young women prefer anarchy. In classic advertising style, Mother Earth also describes nature as saturated with love. In the first issue, when describing a budding relationship crushed by the coldness of artifice and modern living, â€Å"The Tragedy of Women’s Emancipation† explains that â€Å"poetry and the enthusiasm of love cover their blushing faces before the pure beauty of the lady. Her admirer] silences the voice of his nature and remains correct. † The article condemns his correctitude as exactly the basic problem of modern living – its disconnect from love and contact. Tragically, the beauty of the lady, just as that of the kindly mother Earth, has been tainted to block the â€Å"poetry† and â€Å"enthusiasm of love† the article considers natural. In contrast to t he authentic state of love the various ‘systems’ of which anarchism complains give us poor simulations of affection: marriage and the nuclear family.In volume 3, number five, the article â€Å"Light and Shadows in the Life of an Avant-Gard†, we learn The poor women, thousands of them, abused, insulted, and outraged by their precious husbands, must continue a life of degradation. They have no money to join the colony in Reno. No relief for them. The poor women, the slaves of the slaves, must go on prostituting themselves. They must continue to bear children in hate, in conflict, in physical horror. The marriage institution and the â€Å"sanctity of the home† are only for those who have not the money to buy themselves free from both, even as the chattel slave from his master.Nature offers real love, civilization offers a slavery titled love. These stark terms of opposition function to set up an understanding of a loving motherly nature that makes it obviousl y superior to the uncaring childlike cruelties that comprise the artificial world. As is often thought, nature is also connected with freedom. It is quite arbitrary to say that those things to which a life in ‘nature’ is conducive represent the content of freedom. For instance, in nature one is not free to vote or go to work, and yet this is considered irrelevant to questions of liberty.In volume two, number three, of Mother Earth, the article â€Å"Liberty† proclaims that â€Å"whatever may be the form of social institutions, if it does no more than to declare and enforce well-known rules of natural justice, then I am free. † The simplistic opposition between the compromises of ‘artificial’ life and the freedom of nature is best exemplified in the pithy quote â€Å"Liberty escaped into the wilderness† from the journal’s founding article. This unbounded freedom seems excessively unrealistic as a description of a mother, and yet i t is precisely the freedom that mothers lacked that the journal constructs nature as having in spades.At the same time, the infinite youth, beauty, and inescapable freedom in and of nature primarily complement its fundamentally orderly state. Perhaps in one of the most bizarre fixations of anarchist literature, the journal seems careful to point out the extreme orderliness of life in anarchy. In this kind of reconciliation of total freedom and total justice one can actually see the neurosis of liberalism tentatively suggest what it most wishes simply come true: good freedom and good order. The very first issue, in the rticle â€Å"Without Government† we are told that, there are qualities present in man, which permit the possibilities of social life, organization, and co-operative work without the application of force. Such qualities are solidarity, common action, and love of justice. To-day they are either crippled [sic] or made ineffective through the influence of compulsion ; they can hardly be fully unfolded in a society in which groups, classes, and individuals are placed in hostile, irreconcilable opposition to one anotherAgain, like an orderly housewife, nature maintains a world that works, but without even so much as a broom. Instead, nature works through qualities always already present in people, as natural beings. It is through this sort of argument that anarchism can define government into such a position that it doesn’t even make sense to consider, having already had all its greatest advantages stolen over to the side of nature. Simultaneously, nature’s great assets will be willingly sacrificed to her children in cheerful martyrdom.Like the constructed role of a ‘good mother’, nature â€Å"sees the bleeding feet of her children †¦ hears their moans, and she is ever calling to them that she is theirs† beginning in the founding article of Mother Earth. The article continues to encourage the exploitation of nature because nature is asking for it, here with increasingly vivid maternal imagery. Mother Earth keeps sources of vast wealth hidden within the folds of her ample bosom, extended her inviting and hospitable arms to all those who came to her from arbitrary and despotic lands–Mother Earth ready to give herself alike to all her children.But soon she was seized by the few, stripped of her freedom, fenced in, a prey to those who were endowed with cunning and unscrupulous shrewdness. The rapaciousness of artifice and modern civilization becomes its primary characteristic when put in the terms of a kindly mother fallen prey to vicious quasi-Oedipal domination. Here, again, the journal’s construction of nature as feminine serves the direct political function of discrediting political opponents such as the state, capitalism, and religion.However, the indirect effect of such a construction may be more historically significant, as the natural world becomes increasingly femini zed in particular ways. It is impossible to simply associate nature with feminine, because there is too much to each category. Here the generality is retained on the term of nature – to the degree that it’s distinction from artifice can be kept plausible – and specificity is given to the feminine. Mothers should, in this account, sacrifice everything to their children, no matter how abusive they may be to her.Indeed, every praised trait of Mother Earth is a thinly veiled suggestion for mothers to fulfill. That Mother Earth is huge, inescapable, free and orderly says, at some level, that all good mothers are this way. Thus we end with a political theory laid out in Mother Earth that various artificial systems are bad because they are inferior to a young, beautiful martyr of an omnipresent loving mother who provides both freedom and order.In conclusion, the journal Mother Earth deployed rhetoric in various forms to craft a particular feminine version of nature tha t explicitly worked to delegitimize particular systems of oppression and implicitly functioned to worship an ideal maternal version of womanhood. The journal’s preoccupation with issues of concern to women, such as marriage, prostitution, birth control, and sexuality coincided with its normalizing urge to encounter (some) people as children of nature who could frolic freely within the limitless provisions of their mother’s great world.However, there are actually two possible roles for a subject here, children or mother herself. Politics and men immediately appear infantilized against the mother of nature, supplying a ready-made excuse and index for predicting their actions as irresponsible yet lovable children, but for many women Mother Earth was not their mother, but to be their role model.Nature was a mother whose private sphere expanded to one large planetary home and material limitations in age and restriction were erased by scientific appeal (and pure fiat) to ren der life in nature simultaneously completely free and problem-free. As a solution to the troubles of political theory, the journal instead invented a superhero character to replace the tired images of a drudging, used up, and insensitive nature with a glossy new young, beautiful cover girl – Mother Earth.